Deep sequencing reads for mature sequence MIMAT0018006

Stem-loop ID hsa-mir-3622b
Mature ID hsa-miR-3622b-3p
Reads 
                   hsa-miR-3622b-5p                   hsa-miR-3622b-3p                           Count     RPM (mean number of reads per million)
AGUGAUAUAAUAGAGGGUGCACAGGCAUGGGAGGUCAGGUGAGCUCAGCUCCCUGCCUCACCUGAGCUCCCGUGCCUGUGCACCCUCUAUUGGCU
.......((((((((((((((((((((((((((.(((((((((..(((....))).))))))))).))))))))))))))))))))))))))... (-73.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).