Deep sequencing reads for mature sequence MIMAT0017988

Stem-loop ID hsa-mir-3611
Mature ID hsa-miR-3611
Reads
                                                    hsa-miR-3611                    Count     RPM (mean number of reads per million)
............AAGAAUUUCUUUUUCUUCACAAU................................................  2         0.169
................................................AAAUUGUGAAGAAAGAAAUUCUUAC..........  19        162
................................................AAAUUGUGAAGAAAGAAAUUCUU............  18        237
................................................AAAUUGUGAAGAAAGAAAUUCUUA...........  12        110
................................................AAAUUGUGAAGAAAGAAAUUCU.............  12        107
................................................AAAUUGUGAAGAAAGAAA.................  2         37.5
................................................AAAUUGUGAAGAAAGAAAUUC..............  2         23.1
................................................AAAUUGUGAAGAAAGAAAUU...............  1         11.6
AGCAGGUCUAAUAAGAAUUUCUUUUUCUUCACAAUUAUGAAAGAAAAGAAAUUGUGAAGAAAGAAAUUCUUACUAGUUUUGCU
((((((.(((.((((((((((((..(((((((((((.............))))))))))))))))))))))).))).)))))) (-31.72)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000110 2melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000159 14 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 5 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 10 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 22 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 24 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 5 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000185 17 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 9 GEO : GSM532923 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2