Deep sequencing reads for mature sequence MIMAT0017732

Stem-loop ID aly-MIR3448
Mature ID aly-miR3448-3p
Reads 
     aly-miR3448-5p                                                     aly-miR3448-3p               Count     RPM (mean number of reads per million)
.......................................................................UGUCUGAGGAUUUUUUUUGU........  1         41.6
.........................................................................UCUGAGGAUUUUUUUUGUGGUC....  6         250
UAUUGACCAGGAAAACAUCUUCAGACACGAGCUUGUCAGUCAAUUCCCAGACUUGACUUGACACAAACUCAUGUCUGAGGAUUUUUUUUGUGGUCAAUA
(((((((((.(((((.(((((((((((.(((..((((((((((.((...)).))))).)))))....))).)))))))))))..))))).))))))))) (-44.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000207 12rosette leaf GEO : GSM451894 8 weeks [ Ma Z et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20407023 "Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus" Ma Z, Coruh C, Axtell MJ Plant Cell. 22:1090-1103(2010).