Deep sequencing reads for mature sequence MIMAT0017343

Stem-loop ID mmu-mir-1947
Mature ID mmu-miR-1947-3p
Reads 
             mmu-miR-1947-5p                     mmu-miR-1947-3p                        Count     RPM (mean number of reads per million)
.............GAGGACGAGCUAGCUGAGUGCU..................................................  4         0.014
..............AGGACGAGCUAGCUGAGUGCUG.................................................  665       4.7
..............AGGACGAGCUAGCUGAGUGCU..................................................  283       1.41
..............AGGACGAGCUAGCUGAGUGC...................................................  65        0.341
..............AGGACGAGCUAGCUGAGUG....................................................  15        0.135
..............AGGACGAGCUAGCUGAGUGCUGC................................................  7         0.0333
...............GGACGAGCUAGCUGAGUGCU..................................................  2         0.00467
...............GGACGAGCUAGCUGAGUGCUG.................................................  1         0.0038
..................................................GCACUGAGCUAGCUCUCCCUCC.............  1         0.00376
GAACAAGGUGGUGGAGGACGAGCUAGCUGAGUGCUGCAGACACUCUAAGAGCACUGAGCUAGCUCUCCCUCCAUGCCCUGCUCAA
((...(((..(((((((..(((((((((.((((((..((.....))...)))))).)))))))))..)))))))..)))..)).. (-45.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000032 1testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000034 2testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000038 1brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 4brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000045 1whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000047 3whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000052 3whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000054 2embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 2embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000062 1embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 55bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 26bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 23spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 10spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 19spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 21spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 11spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 1spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 31spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 7peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 6spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 32lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 7lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 26bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 10bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 21bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 63peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 14peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 31bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 11bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 15spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 18thymus GEO : GSM539856
ER0000000238 19spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 34spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 43spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 29lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 37lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 55lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 53spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 7lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 7lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 34 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 22 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 3heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 32brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 18lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 14liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 46kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 7pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 14skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 10skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 8salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 8testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 15ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 13spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 44lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).