Deep sequencing reads for mature sequence MIMAT0017259

Stem-loop IDmmu-mir-505
Mature IDmmu-miR-505-5p
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                   mmu-miR-505-5p                     mmu-miR-505-3p                        Count     RPM (mean number of reads per million)
...................GGGAGCCAGGAAGUAUUGAUGUU................................................  1731      5.92
...................GGGAGCCAGGAAGUAUUGAUGU.................................................  777       3.65
...................GGGAGCCAGGAAGUAUUGAUGUUU...............................................  517       1.94
...................GGGAGCCAGGAAGUAUUGAUG..................................................  114       0.417
...................GGGAGCCAGGAAGUAUUGAU...................................................  88        0.413
...................GGGAGCCAGGAAGUAUUGAUGUUUC..............................................  54        0.182
...................GGGAGCCAGGAAGUAUUGA....................................................  16        0.039
...................GGGAGCCAGGAAGUAUUGAUGUUUCU.............................................  12        0.0321
....................GGAGCCAGGAAGUAUUGAUGUU................................................  4         0.0104
....................GGAGCCAGGAAGUAUUGAUGUUU...............................................  3         0.023
....................GGAGCCAGGAAGUAUUGAUGU.................................................  2         0.00562
....................GGAGCCAGGAAGUAUUGAU...................................................  1         0.00203
.....................GAGCCAGGAAGUAUUGAUGU.................................................  1         0.00235
......................AGCCAGGAAGUAUUGAUGUUU...............................................  1         0.00233
.......................................................CGUCAACACUUGCUGGUUUUCUCU...........  49        0.451
.......................................................CGUCAACACUUGCUGGUUUUCU.............  48        0.382
.......................................................CGUCAACACUUGCUGGUUUUCUC............  39        0.265
.......................................................CGUCAACACUUGCUGGUUUUC..............  14        0.116
.......................................................CGUCAACACUUGCUGGU..................  2         0.0125
........................................................GUCAACACUUGCUGGUUUUCUCU...........  72        0.631
........................................................GUCAACACUUGCUGGUUUUCUC............  53        0.434
........................................................GUCAACACUUGCUGGUUUUCU.............  25        0.272
........................................................GUCAACACUUGCUGGUUUUC..............  7         0.0238
.........................................................UCAACACUUGCUGGUUUUCUCU...........  42        0.153
.........................................................UCAACACUUGCUGGUUUUCU.............  27        0.15
.........................................................UCAACACUUGCUGGUUUUCUC............  10        0.0522
.........................................................UCAACACUUGCUGGUUUUC..............  6         0.0293
.........................................................UCAACACUUGCUGGUUUU...............  1         0.00245
..........................................................CAACACUUGCUGGUUUUCUCU...........  1         0.00265
...........................................................AACACUUGCUGGUUUUCU.............  2         0.00444
...........................................................AACACUUGCUGGUUUUCUC............  2         0.00491
...........................................................AACACUUGCUGGUUUUCUCU...........  2         0.00476
............................................................ACACUUGCUGGUUUUCUCUC..........  1         0.00284
AAAUUGAUGCACCCAGUGGGGGAGCCAGGAAGUAUUGAUGUUUCUGCCAGGUUAGCGUCAACACUUGCUGGUUUUCUCUCUGGAGUAUCA
....((((((..((((.(((..((((((.((((.((((((((.((....))..)))))))).)))).))))))..))).)))).)))))) (-43.20)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000031 OvaryGEO : GSM510435 [ Chiang HR et al.]
ER0000000033 TestesGEO : GSM510437 [ Chiang HR et al.]
ER0000000034 TestesGEO : GSM510438 [ Chiang HR et al.]
ER0000000036 BrainGEO : GSM510440 [ Chiang HR et al.]
ER0000000037 BrainGEO : GSM510441 [ Chiang HR et al.]
ER0000000038 BrainGEO : GSM510442 [ Chiang HR et al.]
ER0000000039 BrainGEO : GSM510443 [ Chiang HR et al.]
ER0000000040 BrainGEO : GSM510444 [ Chiang HR et al.]
ER0000000042 Whole bodyGEO : GSM510446Newborn[ Chiang HR et al.]
ER0000000043 Whole bodyGEO : GSM510447Newborn[ Chiang HR et al.]
ER0000000044 Whole bodyGEO : GSM510448Newborn[ Chiang HR et al.]
ER0000000045 Whole bodyGEO : GSM510449Newborn[ Chiang HR et al.]
ER0000000046 Whole bodyGEO : GSM510450Newborn[ Chiang HR et al.]
ER0000000047 Whole bodyGEO : GSM510451Newborn[ Chiang HR et al.]
ER0000000048 Whole bodyGEO : GSM510452Newborn[ Chiang HR et al.]
ER0000000049 Whole bodyGEO : GSM510453Newborn[ Chiang HR et al.]
ER0000000050 Whole bodyGEO : GSM510454Newborn[ Chiang HR et al.]
ER0000000051 Whole bodyGEO : GSM510455Newborn[ Chiang HR et al.]
ER0000000052 Whole bodyGEO : GSM510456Newborn[ Chiang HR et al.]
ER0000000053 EmbryoGEO : GSM510457Day: 12.5[ Chiang HR et al.]
ER0000000054 EmbryoGEO : GSM510458Day: 12.5[ Chiang HR et al.]
ER0000000055 EmbryoGEO : GSM510459Day: 12.5[ Chiang HR et al.]
ER0000000056 EmbryoGEO : GSM510460Day: 12.5[ Chiang HR et al.]
ER0000000057 EmbryoGEO : GSM510461Day: 9.5[ Chiang HR et al.]
ER0000000058 EmbryoGEO : GSM510462Day: 9.5[ Chiang HR et al.]
ER0000000059 EmbryoGEO : GSM510463Day: 9.5[ Chiang HR et al.]
ER0000000060 EmbryoGEO : GSM510464Day: 9.5[ Chiang HR et al.]
ER0000000061 EmbryoGEO : GSM510465Day: 7.5[ Chiang HR et al.]
ER0000000062 EmbryoGEO : GSM510466Day: 7.5[ Chiang HR et al.]
ER0000000063 EmbryoGEO : GSM510467Day: 7.5[ Chiang HR et al.]
ER0000000216 Bone marrowGEO : GSM539835Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000217 Bone marrowGEO : GSM539836Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000218 SpleenGEO : GSM539837Strain: C57BL/6J; Gender: male; Isolation: Fluorescence activated cell sorting
ER0000000219 SpleenGEO : GSM539838Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000220 SpleenGEO : GSM539839Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000221 SpleenGEO : GSM539840Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000222 SpleenGEO : GSM539841Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000223 SpleenGEO : GSM539842Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000224 SpleenGEO : GSM539843Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000225 Peritoneal lavageGEO : GSM539844Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000226 SpleenGEO : GSM539845Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000227 Lymph nodesGEO : GSM539846Strain: C57BL/6J, Gender: Male, Isolation: Fluorescence activated cell sorting
ER0000000228 Lymph nodesGEO : GSM539847Strain: IL-6 transgenic; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000229 Bone marrowGEO : GSM539848Strain: C57BL/6J; Gender: Male
ER0000000230 Bone marrowGEO : GSM539849Strain: C57BL/6J; Gender: Male
ER0000000231 Bone marrowGEO : GSM539850Strain: C57BL/6J; Gender: Male
ER0000000232 Peritoneal lavageGEO : GSM539851Strain: C57BL/6J; Gender: Male
ER0000000233 Peritoneal lavageGEO : GSM539852Strain: C57BL/6J; Gender: Male
ER0000000234 Bone marrowGEO : GSM539853Strain: C57BL/6J; Gender: Male
ER0000000235 Bone marrowGEO : GSM539854Strain: C57BL/6J; Gender: Male
ER0000000236 SpleenGEO : GSM539855Strain: RAG-/- ; Gender: Male
ER0000000237 ThymusGEO : GSM539856
ER0000000238 SpleenGEO : GSM539857Strain: C57BL/6J; Gender: Male
ER0000000239 SpleenGEO : GSM539858Strain: C57BL/6J; Gender: Male
ER0000000240 SpleenGEO : GSM539859Strain: C57BL/6J; Gender: Male
ER0000000241 Lymph nodes/spleenGEO : GSM539860Strain: C57BL/6J; Gender: Male
ER0000000242 Lymph nodes/spleenGEO : GSM539861Strain: C57BL/6J; Gender: Male
ER0000000243 Lymph nodes/spleenGEO : GSM539862Strain: C57BL/6J, Gender: Male
ER0000000244 SpleenGEO : GSM539863Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000245 Lymph nodes/spleenGEO : GSM539864Strain: C57BL/6J; Gender: Male
ER0000000246 Lymph nodes/spleenGEO : GSM539865Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000247 GEO : GSM539866Strain: C57BL/6-129
ER0000000248 GEO : GSM539867Strain: C57BL/6J; Developmental stage: E13.5
ER0000000249 HeartGEO : GSM539868Strain: C57BL/6J; Gender: Male
ER0000000250 BrainGEO : GSM539869Strain: C57BL/6J; Gender: Male
ER0000000251 LungGEO : GSM539870Strain: C57BL/6J; Gender: Male
ER0000000252 LiverGEO : GSM539871Strain: C57BL/6J; Gender: Male
ER0000000253 KidneyGEO : GSM539872Strain: C57BL/6J; Gender: Male
ER0000000254 PancreasGEO : GSM539873Strain: C57BL/6J; Gender: Male
ER0000000255 SkinGEO : GSM539874Strain: C57BL/6J; Gender: Male
ER0000000256 Skeletal muscleGEO : GSM539875Strain: C57BL/6J; Gender: Male
ER0000000257 Salivary glandsGEO : GSM539876Strain: C57BL/6J; Gender: Male
ER0000000258 TestesGEO : GSM539877Strain: C57BL/6J; Gender: Male
ER0000000259 OvaryGEO : GSM539878Strain: C57BL/6J; Gender: Female
ER0000000260 SpleenGEO : GSM539879Strain: BclXL transgenic BalbC; Gender: Male
ER0000000261 Lymph nodesGEO : GSM539880Strain: BclXL transgenic BalbC; Gender: Male
ER0000000415 NIH-3T3 cellGEO : GSM774079Cell cycle arrest: Contact inhibition; Cell cycle phase: Asynchronous; Cell type: Fibroblast
ER0000000416 NIH-3T3 cellGEO : GSM774080Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000417 NIH-3T3 cellGEO : GSM774081Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000490 BrainGEO : GSM995310Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000491 CerebellumGEO : GSM995311Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000492 HeartGEO : GSM995312Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000493 KidneyGEO : GSM995313Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000510 Sertoli cells GEO : GSM995330Age: Pool of individuals; Gender: Male[ Meunier J et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).