Deep sequencing reads for mature sequence MIMAT0017046

Stem-loop ID mmu-mir-101b
Mature ID mmu-miR-101b-5p
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                      mmu-miR-101b-5p                     mmu-miR-101b-3p                          Count     RPM (mean number of reads per million)
.UCUGAGACUGAACUGCCCUUUUU.........................................................................  3         0.0101
.UCUGAGACUGAACUGCCCUUUU..........................................................................  1         0.00369
.UCUGAGACUGAACUGCCCUUUUUCG.......................................................................  1         0.00275
..CUGAGACUGAACUGCCCUUUUU.........................................................................  6         0.0266
..CUGAGACUGAACUGCCCUUUU..........................................................................  6         0.0248
..CUGAGACUGAACUGCCCUUU...........................................................................  2         0.00629
...UGAGACUGAACUGCCCUUUU..........................................................................  1         0.00715
....GAGACUGAACUGCCCUUUUU.........................................................................  4         0.00533
.....AGACUGAACUGCCCUUUUU.........................................................................  12        0.037
.......................UCGGUUAUCAUGGUACCGAUGCU...................................................  6         0.0577
.......................UCGGUUAUCAUGGUACCGAUG.....................................................  4         0.0431
.......................UCGGUUAUCAUGGUACCGAU......................................................  3         0.0785
.......................UCGGUUAUCAUGGUACCGAUGC....................................................  1         0.593
........................CGGUUAUCAUGGUACCGAUGCU...................................................  5         0.0333
........................CGGUUAUCAUGGUACCGAUGCUG..................................................  2         0.02
........................CGGUUAUCAUGGUACCGA.......................................................  1         0.00219
.........................GGUUAUCAUGGUACCGAUGCUG..................................................  1         0.01
.......................................CGAUGCUGUAGCUCUGAAAGGUA...................................  1         0.0023
.............................................UGUAGCUCUGAAAGGUACAGUACU............................  3         0.0105
.............................................UGUAGCUCUGAAAGGUACAG................................  1         0.00715
.............................................UGUAGCUCUGAAAGGUACAGUAC.............................  1         0.00459
.............................................UGUAGCUCUGAAAGGUACAGU...............................  1         0.00101
.............................................UGUAGCUCUGAAAGGUACAGUA..............................  1         0.002
...............................................UAGCUCUGAAAGGUACAGUACUG...........................  1         0.0023
......................................................GAAAGGUACAGUACUGUGAUAGCU...................  1         0.0088
..........................................................GGUACAGUACUGUGAUAGCU...................  1         0.00101
..........................................................GGUACAGUACUGUGAUAGCUGAA................  1         0.00435
...........................................................GUACAGUACUGUGAUAGCU...................  333058    1e+03
...........................................................GUACAGUACUGUGAUAGCUGAA................  46637     226
...........................................................GUACAGUACUGUGAUAGCUGA.................  40712     268
...........................................................GUACAGUACUGUGAUAGCUG..................  27293     97.4
...........................................................GUACAGUACUGUGAUAGC....................  6609      21.5
...........................................................GUACAGUACUGUGAUAGCUGAAG...............  516       1.95
...........................................................GUACAGUACUGUGAUAGCUGAAGA..............  313       1.03
...........................................................GUACAGUACUGUGAUAG.....................  115       1.43
...........................................................GUACAGUACUGUGAUAGCUGAAGAA.............  19        0.0599
...........................................................GUACAGUACUGUGAUAGCUGAAGAAU............  1         0.00329
............................................................UACAGUACUGUGAUAGCUGAAG...............  58977     424
............................................................UACAGUACUGUGAUAGCUG..................  38738     135
............................................................UACAGUACUGUGAUAGCUGAA................  35528     180
............................................................UACAGUACUGUGAUAGCUGAAGA..............  33151     112
............................................................UACAGUACUGUGAUAGCUGA.................  20374     143
............................................................UACAGUACUGUGAUAGCUGAAGAA.............  1967      6.24
............................................................UACAGUACUGUGAUAGCU...................  98        1.35
............................................................UACAGUACUGUGAUAGCUGAAGAAU............  53        0.2
............................................................UACAGUACUGUGAUAGC....................  45        0.399
............................................................UACAGUACUGUGAUAGCUGAAGAAUG...........  2         0.00568
.............................................................ACAGUACUGUGAUAGCUGAAG...............  3660      17.2
.............................................................ACAGUACUGUGAUAGCUGAAGA..............  3032      11.1
.............................................................ACAGUACUGUGAUAGCUGAA................  1799      7.5
.............................................................ACAGUACUGUGAUAGCUGA.................  1038      4.49
.............................................................ACAGUACUGUGAUAGCUGAAGAA.............  294       0.964
.............................................................ACAGUACUGUGAUAGCU...................  10        0.415
.............................................................ACAGUACUGUGAUAGCUGAAGAAU............  10        0.0276
.............................................................ACAGUACUGUGAUAGCUG..................  8         0.207
..............................................................CAGUACUGUGAUAGCUGAAGA..............  319       1.16
..............................................................CAGUACUGUGAUAGCUGAAG...............  183       0.774
..............................................................CAGUACUGUGAUAGCUGAA................  81        0.387
..............................................................CAGUACUGUGAUAGCUGAAGAA.............  72        0.215
..............................................................CAGUACUGUGAUAGCUGA.................  22        0.199
..............................................................CAGUACUGUGAUAGCUGAAGAAU............  9         0.0519
..............................................................CAGUACUGUGAUAGCUG..................  1         0.00817
...............................................................AGUACUGUGAUAGCUGA.................  46        0.64
...............................................................AGUACUGUGAUAGCUGAA................  24        0.278
...............................................................AGUACUGUGAUAGCUGAAG...............  15        0.121
...............................................................AGUACUGUGAUAGCUGAAGA..............  7         0.0339
...............................................................AGUACUGUGAUAGCUGAAGAA.............  2         0.00735
................................................................GUACUGUGAUAGCUGAA................  20        0.286
................................................................GUACUGUGAUAGCUGAAG...............  7         0.0912
................................................................GUACUGUGAUAGCUGAAGA..............  1         0.0119
.................................................................UACUGUGAUAGCUGAAG...............  3         0.058
..................................................................ACUGUGAUAGCUGAAGA..............  1         0.01
AUCUGAGACUGAACUGCCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAGCUCUGAAAGGUACAGUACUGUGAUAGCUGAAGAAUGGCGGUGCCAUC
.........((.((((((.((((((((((((((((((......((((((.((.....)).)))))))))))))))))))))))).))))))..)).. (-39.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000028 13ovary GEO : GSM510432 [ Chiang HR et al.]
ER0000000029 709ovary GEO : GSM510433 [ Chiang HR et al.]
ER0000000030 896ovary GEO : GSM510434 [ Chiang HR et al.]
ER0000000031 79ovary GEO : GSM510435 [ Chiang HR et al.]
ER0000000032 118testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000033 462testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000034 625testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000035 87testes GEO : GSM510439 [ Chiang HR et al.]
ER0000000036 2026brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 6654brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 10736brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000039 1395brain GEO : GSM510443 [ Chiang HR et al.]
ER0000000040 49426brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000041 154whole body GEO : GSM510445 newborn [ Chiang HR et al.]
ER0000000042 659whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 1181whole body GEO : GSM510447 newborn [ Chiang HR et al.]
ER0000000044 224whole body GEO : GSM510448 newborn [ Chiang HR et al.]
ER0000000045 1945whole body GEO : GSM510449 newborn [ Chiang HR et al.]
ER0000000046 2766whole body GEO : GSM510450 newborn [ Chiang HR et al.]
ER0000000047 3310whole body GEO : GSM510451 newborn [ Chiang HR et al.]
ER0000000048 3272whole body GEO : GSM510452 newborn [ Chiang HR et al.]
ER0000000049 3099whole body GEO : GSM510453 newborn [ Chiang HR et al.]
ER0000000050 3144whole body GEO : GSM510454 newborn [ Chiang HR et al.]
ER0000000051 2916whole body GEO : GSM510455 newborn [ Chiang HR et al.]
ER0000000052 24699whole body GEO : GSM510456 newborn [ Chiang HR et al.]
ER0000000053 1124embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 3547embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 6005embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 819embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000057 1600embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 3464embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 5507embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 411embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 2084embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 4204embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 6221embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 5888bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 3576bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 2565spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 4829spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 16073spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 9955spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 31409spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 23740spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 11547spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 7353peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 4976spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 3310lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 2992lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 15172bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 28977bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 24913bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 18740peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 3462peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 7184bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 10643bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 10149spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 3893thymus GEO : GSM539856
ER0000000238 20092spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 29538spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 11918spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 33574lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 67361lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 44102lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 69271spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 24254lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 15914lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 49441 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 5765 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 1835heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 17812brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 12753lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000252 13822liver GEO : GSM539871 strain: C57BL/6J, gender: male
ER0000000253 29710kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 26005pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 29922skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 9499skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 28725salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 2919testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 6276ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 24155spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 14278lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male
ER0000000415 68NIH-3T3 cell GEO : GSM774079 cell cycle arrest: Contact inhibition, cell cycle phase: Asynchronous, cell type: Fibroblast
ER0000000416 604NIH-3T3 cell GEO : GSM774080 cell cycle arrest: Contact inhibition, cell cycle phase: G0, cell type: Fibroblast
ER0000000417 926NIH-3T3 cell GEO : GSM774081 cell cycle arrest: Contact inhibition, cell cycle phase: G0, cell type: Fibroblast
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).