Deep sequencing reads for mature sequence MIMAT0016876

Stem-loop ID

hsa-mir-4324

Mature ID

hsa-miR-4324

Reads

                                           hsa-miR-4324                   Count     RPM (mean number of reads per million)
......................................AAAACCCUGAGACCCUAAC...............  10        115
......................................AAAACCCUGAGACCCUAA................  4         47.8
......................................AAAACCCUGAGACCCUA.................  2         28.4
CGGCCCCUUUGUUAAGGGUCUCAGCUCCAGGGAACUUUAAAACCCUGAGACCCUAACCUUAAAGGUGCUGCA
((((.((((((...((((((((((.....((...........)))))))))))).....)))))).)))).. (-28.10)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000137	4		GEO : GSM532873	normal cervix	[ Witten D et al.]
ER0000000139	5		GEO : GSM532875	normal cervix	[ Witten D et al.]
ER0000000143	8		GEO : GSM532879	normal cervix	[ Witten D et al.]
ER0000000149	4		GEO : GSM532885	normal cervix	[ Witten D et al.]
ER0000000153	5		GEO : GSM532889	normal cervix	[ Witten D et al.]
ER0000000155	69		GEO : GSM532891	normal cervix	[ Witten D et al.]
ER0000000159	6		GEO : GSM532895	normal cervix	[ Witten D et al.]
ER0000000161	1		GEO : GSM532897	normal cervix	[ Witten D et al.]
ER0000000163	56		GEO : GSM532899	normal cervix	[ Witten D et al.]
ER0000000165	2		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000167	150		GEO : GSM532903	normal cervix	[ Witten D et al.]
ER0000000173	117		GEO : GSM532909	normal cervix	[ Witten D et al.]
ER0000000177	27		GEO : GSM532913	normal cervix	[ Witten D et al.]
ER0000000179	48		GEO : GSM532915	normal cervix	[ Witten D et al.]
ER0000000181	1		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000185	369		GEO : GSM532921	normal cervix	[ Witten D et al.]
ER0000000187	256		GEO : GSM532923	normal cervix	[ Witten D et al.]

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).