Deep sequencing reads for mature sequence MIMAT0015577

Stem-loop ID bmo-mir-3383
Mature ID bmo-miR-3383-5p
Reads 
      bmo-miR-3383-5p                                bmo-miR-3383-3p             Count     RPM (mean number of reads per million)
........................................................CGAAGUUGACGCGCUGUCUC..  1         0.35
..........................................................AAGUUGACGCGCUGUCUCUU  6         4.93
GAAAUAGUGCCUGAGGGCUUCGUCCAUGUUCGCGUCGGCCGUCGUCGCGUGUGCCACGAAGUUGACGCGCUGUCUCUU
((.(((((((.....((((((((....((.((((.((((....)))))))).)).))))))))...))))))).)).. (-27.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000269 4anterior silk glands GEO : GSM449726 5th-instar day-3 larvae [ Liu S et al.]
ER0000000270 6posterior silk glands GEO : GSM449727 5th-instar day-3 larvae [ Liu S et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).