Deep sequencing reads for mature sequence MIMAT0015064

Stem-loop ID

hsa-mir-3184

Mature ID

hsa-miR-3184-5p

Reads

         hsa-miR-3184-5p                  hsa-miR-3184-3p                    Count     RPM (mean number of reads per million)
.........UGAGGGGCCUCAGACCGAGCUUU...........................................  44        7.48
.........UGAGGGGCCUCAGACCGAGCUUUU..........................................  33        231
AAGCAAGACUGAGGGGCCUCAGACCGAGCUUUUGGAAAAUAGAAAAGUCUCGCUCUCUGCCCCUCAGCCUAACUU
(((..((.(((((((((...(((.(((((((((.........))))).)))).)))..))))))))).))..))) (-30.30)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000103	2	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000108	7	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000110	26	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	6	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000114	7	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000152	1	squamous cell	GEO : GSM532888		[ Witten D et al.]
ER0000000155	1		GEO : GSM532891	normal cervix	[ Witten D et al.]
ER0000000159	1		GEO : GSM532895	normal cervix	[ Witten D et al.]
ER0000000163	1		GEO : GSM532899	normal cervix	[ Witten D et al.]
ER0000000167	5		GEO : GSM532903	normal cervix	[ Witten D et al.]
ER0000000172	1	squamous cell	GEO : GSM532908		[ Witten D et al.]
ER0000000173	1		GEO : GSM532909	normal cervix	[ Witten D et al.]
ER0000000177	14		GEO : GSM532913	normal cervix	[ Witten D et al.]
ER0000000179	5		GEO : GSM532915	normal cervix	[ Witten D et al.]
ER0000000185	2		GEO : GSM532921	normal cervix	[ Witten D et al.]
ER0000000187	2		GEO : GSM532923	normal cervix	[ Witten D et al.]

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).