Deep sequencing reads for mature sequence MIMAT0015038

Stem-loop ID

hsa-mir-3164

Mature ID

hsa-miR-3164

Reads

           hsa-miR-3164                                                              Count     RPM (mean number of reads per million)
.........UGUGACUUUAAGGGAAAUGGCG....................................................  157       7.77
CUUGGAAACUGUGACUUUAAGGGAAAUGGCGCACAGCAGACCCUGCAAUCAUGCCGUUUUGCUUGAAGUCGCAGUUUCCCAGG
((.((((((((((((((((((.(((((((((....((((...)))).....))))))))).)))))))))))))))))).)). (-46.30)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000103	62	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	6	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	3		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	2	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	9	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	10	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	8	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	46	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	4	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	17	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	2	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	14	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000177	1		GEO : GSM532913	normal cervix	[ Witten D et al.]

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).