Deep sequencing reads for mature sequence MIMAT0015007

Stem-loop ID hsa-mir-3139
Mature ID hsa-miR-3139
Reads 
           hsa-miR-3139                                                      Count     RPM (mean number of reads per million)
.........UAGGAGCUCAACAGAUGCCUGU.............................................  12        1.44
.........UAGGAGCUCAACAGAUGCCUGUU............................................  5         0.645
GGCUCAGAGUAGGAGCUCAACAGAUGCCUGUUGACUGAAUAAUAAACAGGUAUCGCAGGAGCUUUUGUUAUGUGCC
(((.((...(((((((((....((((((((((............))))))))))....)))))))))...)).))) (-32.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 7melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 8melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000164 1squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).