Deep sequencing reads for mature sequence MIMAT0014998

Stem-loop ID

hsa-mir-3133

Mature ID

hsa-miR-3133

Reads

           hsa-miR-3133                                                         Count     RPM (mean number of reads per million)
.........UAAAGAACUCUUAAAACCCAAU...............................................  17        1.38
..........AAAGAACUCUUAAAACCCAAU...............................................  6         0.404
CAGAAAUUGUAAAGAACUCUUAAAACCCAAUAGUAAAAAGACAACCUGUUGAGUUUUAAGAGUUCUUUAUAUAUUCUG
(((((..(((((((((((((((((((.((((((............)))))).)))))))))))))))))))..))))) (-33.10)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000103	2	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	4	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	4		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	2	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000108	4	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	2	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000111	3	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	4	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000157	1		GEO : GSM532893	normal cervix	[ Witten D et al.]

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).