Deep sequencing reads for mature sequence MIMAT0013545

Stem-loop ID cte-mir-2691
Mature ID cte-miR-2691-3p
Confidence
Feedback: Do you believe this miRNA is real?
Reads
           cte-miR-2691-5p                             cte-miR-2691-3p                    Count     RPM (mean number of reads per million)
............GACGGUGAGACUUCUGCAAAGC......................................................  1         29
........................................................UUUUGCAAAGUAUCACAGCCUG..........  9         261
........................................................UUUUGCAAAGUAUCACAGCCU...........  1         29
........................................................UUUUGCAAAGUAUCACAGCCUGU.........  1         29
CUACUGCAGGCCGACGGUGAGACUUCUGCAAAGCCGUGUCAUUUGCAAAUAACAGGUUUUGCAAAGUAUCACAGCCUGUCUGCGGUAU
.((((((((((.(.(.((((.((((.(((((((((.(((.(((....))).)))))))))))))))).)))).).).)))))))))). (-38.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000125 13Whole body [ Wheeler BM et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).