Deep sequencing reads for mature sequence MIMAT0011719

Stem-loop ID ppc-mir-2238e
Mature ID ppc-miR-2238e
Reads 
                                                           ppc-miR-2238e                          Count     RPM (mean number of reads per million)
...........................................................AAUGACAGAACAGUGCGCGAG.................  4         437
...........................................................AAUGACAGAACAGUGCGCG...................  2         218
GGUACCUAGUCUUUUCUCUUUCCCGUUCACUCUUCUCGUCAGUCGAUGAUCGAAUAUAGAAUGACAGAACAGUGCGCGAGAAGGAAGACUAGCUUCC
((...(((((((....((((((.(((.((((.((((.((((.(((.....)))........)))))))).)))).))).)))))))))))))...)) (-33.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000027 33whole body GEO : GSM378787 [ de Wit E et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).