Deep sequencing reads for mature sequence MIMAT0011603

Stem-loop ID crm-mir-38
Mature ID crm-miR-38
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                                                                             crm-miR-38                                   Count     RPM (mean number of reads per million)
UCCGAUUGGUUGAAAGAGCCAGAACCUAUACCGGUUUAACUUCGUGGUGAUAUGACACAUAUUACAUUCUUUAUCACCGGGAGUAAAACUGGUAUAGGAUCUGCGACUCGCUGAUUGGAA
((((((..((.....((((((((.(((((((((((((.(((((.((((((((...................))))))))))))).))))))))))))).)))).).)))))..)))))). (-53.91)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000026 2whole body GEO : GSM378786 [ de Wit E et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).