Deep sequencing reads for mature sequence MIMAT0011160

Stem-loop ID hsa-mir-2116
Mature ID hsa-miR-2116-5p
Reads
           hsa-miR-2116-5p                      hsa-miR-2116-3p                   Count     RPM (mean number of reads per million)
GACCUAGGCUAGGGGUUCUUAGCAUAGGAGGUCUUCCCAUGCUAAGAAGUCCUCCCAUGCCAAGAACUCCCAGACUAGGA
..(((((.((.(((((((((.((((.(((((.((((.........)))).))))).)))).))))))))).)).))))). (-42.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000141 1 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000163 2 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000173 5 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 3 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 1 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000185 2 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000186 2squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
2