Deep sequencing reads for mature sequence MIMAT0009465

Stem-loop IDbfl-mir-9-1
Mature IDbfl-miR-9-5p
Reads
        bfl-miR-9-5p                          bfl-miR-9-3p                           Count     RPM (mean number of reads per million)
.....GUCUUUGGUUAUCUAGCUGUAUGA.....................................................  1         20.1
......UCUUUGGUUAUCUAGCUGUAUGA.....................................................  135       2.71e+03
......UCUUUGGUUAUCUAGCUGUAUG......................................................  26        522
......UCUUUGGUUAUCUAGCUGUAU.......................................................  5         100
......UCUUUGGUUAUCUAGCUGUAUGAG....................................................  1         20.1
......UCUUUGGUUAUCUAGCU...........................................................  1         20.1
.......CUUUGGUUAUCUAGCUGUAUG......................................................  1         20.1
GUGUUGUCUUUGGUUAUCUAGCUGUAUGAGAGUCUUUUGUCACCAUAAAGCUAGGUAACCAAAACAACAACCAUUCCCCCUA
.((((((.(((((((((((((((.((((.(.(.(....).).))))).)))))))))))))))))))))............. (-31.60)
Stem-loop IDbfl-mir-9-2
Mature IDbfl-miR-9-5p
Reads
       bfl-miR-9-5p                          bfl-miR-9-3p                            Count     RPM (mean number of reads per million)
....GUCUUUGGUUAUCUAGCUGUAUGA......................................................  1         20.1
.....UCUUUGGUUAUCUAGCUGUAUGA......................................................  135       2.71e+03
.....UCUUUGGUUAUCUAGCUGUAUG.......................................................  26        522
.....UCUUUGGUUAUCUAGCUGUAU........................................................  5         100
.....UCUUUGGUUAUCUAGCUGUAUGAG.....................................................  1         20.1
.....UCUUUGGUUAUCUAGCU............................................................  1         20.1
......CUUUGGUUAUCUAGCUGUAUG.......................................................  1         20.1
UGUUGUCUUUGGUUAUCUAGCUGUAUGAGAGUCUUUUGUCACCAUAAAGCUAGGUAACCAAAACAACAACCAUUCCCCCUAG
((((((.(((((((((((((((.((((.(.(.(....).).))))).))))))))))))))))))))).............. (-31.40)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000131 225Whole body [ Wheeler BM et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).