Deep sequencing reads for mature sequence MIMAT0009428

Stem-loop ID

mmu-mir-1956

Mature ID

mmu-miR-1956

Reads

      mmu-miR-1956                                                 Count     RPM (mean number of reads per million)
...CAGUCCAGGGCUGAGUCAGCGGA.......................................  2         0.0119
...CAGUCCAGGGCUGAGUCAGCGG........................................  1         0.00787
....AGUCCAGGGCUGAGUCAGCGGA.......................................  369       2.29
....AGUCCAGGGCUGAGUCAGCGG........................................  73        0.416
....AGUCCAGGGCUGAGUCAGCG.........................................  23        0.174
....AGUCCAGGGCUGAGUCAGC..........................................  8         0.0425
....AGUCCAGGGCUGAGUCAGCGGAG......................................  2         0.0126
....AGUCCAGGGCUGAGUCAGCGGAGC.....................................  1         0.00653
.....GUCCAGGGCUGAGUCAGCG.........................................  1         0.002
..............UGAGUCAGCGGAGCCCCGAG...............................  1         0.00579
..............UGAGUCAGCGGAGCCCCGAGUG.............................  1         0.002
....................................GCUUCCCUGGCUGGCACC...........  1         0.00476
........................................CCCUGGCUGGCACCUGGACGU....  2         0.00801
........................................CCCUGGCUGGCACCUGGACGUA...  2         0.0154
........................................CCCUGGCUGGCACCUGGACGUAG..  1         0.00401
.........................................CCUGGCUGGCACCUGGACGU....  2         0.0105
CUUCAGUCCAGGGCUGAGUCAGCGGAGCCCCGAGUGGCUUCCCUGGCUGGCACCUGGACGUAGGC
((...((((((((((.((((((.((((((......)))))).))))))))).)))))))..)).. (-36.60)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000038	1	brain	GEO : GSM510442		[ Chiang HR et al.]
ER0000000063	1	embryo	GEO : GSM510467	day 7.5 embryo	[ Chiang HR et al.]
ER0000000216	1	bone marrow	GEO : GSM539835	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217	2	bone marrow	GEO : GSM539836	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218	2	spleen	GEO : GSM539837	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219	2	spleen	GEO : GSM539838	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220	1	spleen	GEO : GSM539839	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221	2	spleen	GEO : GSM539840	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222	9	spleen	GEO : GSM539841	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223	9	spleen	GEO : GSM539842	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224	12	spleen	GEO : GSM539843	strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225	1	peritoneal lavage	GEO : GSM539844	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226	3	spleen	GEO : GSM539845	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227	3	lymph nodes	GEO : GSM539846	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228	7	lymph nodes	GEO : GSM539847	strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229	24	bone marrow	GEO : GSM539848	strain: C57BL/6J, gender: male
ER0000000230	34	bone marrow	GEO : GSM539849	strain: C57BL/6J, gender: male
ER0000000231	72	bone marrow	GEO : GSM539850	strain: C57BL/6J, gender: male
ER0000000232	10	peritoneal lavage	GEO : GSM539851	strain: C57BL/6J, gender: male
ER0000000234	81	bone marrow	GEO : GSM539853	strain: C57BL/6J, gender: male
ER0000000235	8	bone marrow	GEO : GSM539854	strain: C57BL/6J, gender: male
ER0000000236	17	spleen	GEO : GSM539855	strain: RAG-/-, gender: male
ER0000000237	1	thymus	GEO : GSM539856
ER0000000238	2	spleen	GEO : GSM539857	strain: C57BL/6J, gender: male
ER0000000239	2	spleen	GEO : GSM539858	strain: C57BL/6J, gender: male
ER0000000240	19	spleen	GEO : GSM539859	strain: C57BL/6J, gender: male
ER0000000241	24	lymph nodes/spleen	GEO : GSM539860	strain: C57BL/6J, gender: male
ER0000000242	27	lymph nodes/spleen	GEO : GSM539861	strain: C57BL/6J, gender: male
ER0000000243	33	lymph nodes/spleen	GEO : GSM539862	strain: C57BL/6J, gender: male
ER0000000244	28	spleen	GEO : GSM539863	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245	4	lymph nodes/spleen	GEO : GSM539864	strain: C57BL/6J, gender: male
ER0000000246	7	lymph nodes/spleen	GEO : GSM539865	strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247	3		GEO : GSM539866	strain: C57BL/6-129
ER0000000248	3		GEO : GSM539867	strain: C57BL/6J, developmental stage: E13.5
ER0000000249	1	heart	GEO : GSM539868	strain: C57BL/6J, gender: male
ER0000000251	6	lung	GEO : GSM539870	strain: C57BL/6J, gender: male
ER0000000253	4	kidney	GEO : GSM539872	strain: C57BL/6J, gender: male
ER0000000254	5	pancreas	GEO : GSM539873	strain: C57BL/6J, gender: male
ER0000000255	10	skin	GEO : GSM539874	strain: C57BL/6J, gender: male
ER0000000257	5	salivary glands	GEO : GSM539876	strain: C57BL/6J, gender: male
ER0000000259	2	ovary	GEO : GSM539878	strain: C57BL/6J, gender: female
ER0000000260	1	spleen	GEO : GSM539879	strain: BclXL transgenic BalbC, gender: male
ER0000000261	4	lymph nodes	GEO : GSM539880	strain: BclXL transgenic BalbC, gender: male

References

1. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).