Deep sequencing reads for mature sequence MIMAT0007801

Stem-loop ID osa-MIR1861f
Mature ID osa-miR1861f
Reads 
                  osa-miR1861f                                                                                        Count     RPM (mean number of reads per million)
...........AGGCCCGAUCUUGAGGCAGGA....................................................................................  21        5.05
................CGAUCUUGAGGCAGGAACUGAG..............................................................................  44        10.5
................CGAUCUUGAGGCAGGAACUGA...............................................................................  42        9.99
.................GAUCUUGAGGCAGGAACUGAG..............................................................................  42        9.99
....................CUUGAGGCAGGAACUGAG..............................................................................  18        4.24
.................................................................................GGUUCCUGUCCCAAGAUCGAG..............  21        5.05
UGCGUAUUCUUAGGCCCGAUCUUGAGGCAGGAACUGAGUAGUUGUUGAACUUGCUCUAUGUUGUUCGUUCACCCACUAUUCGGUUCCUGUCCCAAGAUCGAGUCUAUGAAUAUACA
.(..(((((.(((((.((((((((.(((((((((((((((((.(.(((((..((........))..))))).).))))))))))))))))).)))))))).))))).)))))..). (-60.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000008 6whole body GEO : GSM407071 [ Johnson C et al.]
ER0000000009 11whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000201 281whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 425whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
2
PMID:21113019 "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)" Li T, Li H, Zhang YX, Liu JY Nucleic Acids Res. 39:2821-2833(2011).