Deep sequencing reads for mature sequence MIMAT0005934

Stem-loop ID hsa-mir-548p
Mature ID hsa-miR-548p
Reads
                                                hsa-miR-548p                          Count     RPM (mean number of reads per million)
..............................................UAGCAAAAACUGCAGUUACUUU................  2         0.0515
...............................................AGCAAAAACUGCAGUUACUUU................  4         0.311
.................................................CAAAAACUGCAGUUACUUUUG..............  2         0.135
AUUAGGUUGGUAUAAAAUUAAUUGCAGUUUUUGUCAUUACUUUCAAUAGCAAAAACUGCAGUUACUUUUGCACCAAUGUAAUAC
((((.((((((.(((((.(((((((((((((((..(((......)))..))))))))))))))).))))).)))))).)))).. (-33.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 3embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 6embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 15melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000105 7 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 3melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 7melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 2melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 4melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000177 2 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3