Deep sequencing reads for mature sequence MIMAT0005930

Stem-loop ID hsa-mir-1276
Mature ID hsa-miR-1276
Reads 
            hsa-miR-1276                                                             Count     RPM (mean number of reads per million)
...........UAAAGAGCCCUGUGGAGACA....................................................  82        5.88
...........UAAAGAGCCCUGUGGAGACACC..................................................  43        2.44
...........UAAAGAGCCCUGUGGAGACAC...................................................  9         0.568
CCCCAGCUAGGUAAAGAGCCCUGUGGAGACACCUGGAUUCAGAGAACAUGUCUCCACUGAGCACUUGGGCCUUGAUGGCGGCU
(((((...((((.(((.((.(.(((((((((((((....))).)....))))))))).).)).)))..))))...))).)).. (-32.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000103 5melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000106 5melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 19melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 20melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 17melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 3melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 17melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 13melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 15melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 22melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000150 1squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).