Deep sequencing reads for mature sequence MIMAT0005911

Stem-loop ID

hsa-mir-1260a

Mature ID

hsa-miR-1260a

Reads

            hsa-miR-1260a                                                  Count     RPM (mean number of reads per million)
.............AUCCCACCUCUGCCACCA..........................................  2         0.0439
ACCUUUCCAGCUCAUCCCACCUCUGCCACCAAAACACUCAUCGCGGGGUCAGAGGGAGUGCCAAAAAAGGUAA
((((((...((...((((...((((((.((..............)))).))))))))..))....)))))).. (-20.64)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	907	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000002	206	embryonic stem cell	GEO : GSM541797		[ Bar M et al.]
ER0000000103	461	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	123	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	1729		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	232	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	517	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	2134	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	300	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	434	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	2158	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	1521	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	288	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	576	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000141	1		GEO : GSM532877	normal cervix	[ Witten D et al.]
ER0000000156	1	squamous cell	GEO : GSM532892		[ Witten D et al.]
ER0000000165	2		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000169	1		GEO : GSM532905	normal cervix	[ Witten D et al.]
ER0000000181	1		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000193	4		GEO : GSM532929	normal cervix	[ Witten D et al.]
ER0000000194	2	squamous cell	GEO : GSM532930		[ Witten D et al.]
ER0000000262	8		GEO : GSM337570	antibody: anti-Ago1 4B8
ER0000000263	2		GEO : GSM337571	antibody: anti-Ago2 11A9
ER0000000264	1		GEO : GSM368181	tissue: undifferentiated NPC	[ Zhu JY et al.]
ER0000000266	1		GEO : GSM368183	tissue: undifferentiated NPC	[ Zhu JY et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).