Deep sequencing reads for mature sequence MIMAT0005893

Stem-loop ID hsa-mir-1305
Mature ID hsa-miR-1305
Reads 
                                                    hsa-miR-1305                        Count     RPM (mean number of reads per million)
..................................................UUUUCAACUCUAAUGGGAGAGA..............  12        5.04
..................................................UUUUCAACUCUAAUGGGAGAG...............  3         1.28
...................................................UUUCAACUCUAAUGGGAGAGA..............  6         2.57
...................................................UUUCAACUCUAAUGGGAGAGACA............  3         1.28
AAGAUCCUGCUGUUUCUACCAUUAGUUUUGAAUGUUUAUUGUAAAGAUACUUUUCAACUCUAAUGGGAGAGACAGCAGGAUUCUCC
..(((((((((((((((.(((((((..(((((....((((.....))))...)))))..))))))).))))))))))))))).... (-39.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000110 2melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 22melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).