Deep sequencing reads for mature sequence MIMAT0005854

Stem-loop ID mmu-mir-467g
Mature ID mmu-miR-467g
Reads 
                                                                                 mmu-miR-467g                            Count     RPM (mean number of reads per million)
GUCUUGUGCAUGCAUAUAUAUAUAUGUGUGUGUGUAUAUAUAUAUACAUAUAUAUACAUACAUACACAUGUAUAUGUAUAUAUACAUACACACACAUAUAUAUAUUCAUGUAUAUAUAUA
....((((.((((((..((((((((((((((((((((.(((((((((((((((((............))))))))))))))))).))))))))))))))))))))..)))))).)))).. (-51.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000032 4testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000033 12testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000034 16testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000035 1testes GEO : GSM510439 [ Chiang HR et al.]
ER0000000036 2brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 21brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 28brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000039 2brain GEO : GSM510443 [ Chiang HR et al.]
ER0000000040 116brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000043 2whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000045 4whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 4whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 9whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 6whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 9whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 7whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 5whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 30whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 2embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 17embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 16embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 3embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000057 8embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 9embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 22embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 8embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 24embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 25embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 7bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 8bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 4spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 3spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 3spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 15spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 64spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 46spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 25spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 3spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 3lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 2lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 38bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 4bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 30peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 11peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 8bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 15bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 1spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 8thymus GEO : GSM539856
ER0000000238 37spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 20spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 23spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 13lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 14lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 52lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 88spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 13lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 164lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 409 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 21 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 1heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 2brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000253 1kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 1pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 1skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 7skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 5salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 5testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 6ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 11spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 10lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).