Deep sequencing reads for mature sequence MIMAT0004927

Stem-loop ID hsa-mir-708
Mature ID hsa-miR-708-3p
Reads
          hsa-miR-708-5p                               hsa-miR-708-3p                     Count     RPM (mean number of reads per million)
..........AAGGAGCUUACAAUCUAGCUGGG.......................................................  158       2.88
..........AAGGAGCUUACAAUCUAGCUGG........................................................  46        24.3
..........AAGGAGCUUACAAUCUAGC...........................................................  4         0.04
...........AGGAGCUUACAAUCUAGCUGG........................................................  1         0.146
.................................GGUAAAUGACUUGCACAUGAACA................................  4         0.04
........................................................CAACUAGACUGUGAGCUUCUAG..........  4         0.106
........................................................CAACUAGACUGUGAGCUUCUAGA.........  4         0.04
........................................................CAACUAGACUGUGAGCUUCUA...........  1         0.246
.........................................................AACUAGACUGUGAGCUUCUAGA.........  13        0.174
.........................................................AACUAGACUGUGAGCUUCUAG..........  3         0.03
AACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAAUGACUUGCACAUGAACACAACUAGACUGUGAGCUUCUAGAGGGCAGGGA
..((((((((.(((((((((((.(((((.((...((..(((.......)))..)).)).))))).))))))))))).))))))))... (-44.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 4embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 2embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000104 4melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 156 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 45melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 8melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 26melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 4melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 6melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 48melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000135 3 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000141 1 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000147 11 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000155 2 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000157 9 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000159 10 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000161 112 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000163 2 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000165 36 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 2 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000168 1adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000169 6 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 15 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 3 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 2squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000175 1 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000177 6 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 2 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000181 16 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 12whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000185 1 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 2 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000266 2 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4