Deep sequencing reads for mature sequence MIMAT0004910

Stem-loop ID hsa-mir-450b
Mature ID hsa-miR-450b-3p
Reads 
         hsa-miR-450b-5p                      hsa-miR-450b-3p                    Count     RPM (mean number of reads per million)
.........UUUUUGCAAUAUGUUCCUGAAU...............................................  1         156
..........UUUUGCAAUAUGUUCCUGAAU...............................................  24        0.926
..........UUUUGCAAUAUGUUCCUGAAUA..............................................  22        1.09
..........UUUUGCAAUAUGUUCCUG..................................................  3         14.6
.............................................UAUUGGGAUCAUUUUGCAUCCAU..........  2         0.0358
...............................................UUGGGAUCAUUUUGCAUCCAU..........  2         0.0646
GCAGAAUUAUUUUUGCAAUAUGUUCCUGAAUAUGUAAUAUAAGUGUAUUGGGAUCAUUUUGCAUCCAUAGUUUUGUAU
((((((((((...(((((.(((.((((.((((..(.......)..)))))))).))).)))))...)))))))))).. (-23.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000103 2melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000105 5 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 3melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 14melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 2melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 2melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 8melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 8melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 12melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000142 1squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000148 2squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000158 2squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000176 5adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000182 1squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000263 4 GEO : GSM337571 antibody: anti-Ago2 11A9
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).