Deep sequencing reads for mature sequence MIMAT0004806

Stem-loop ID hsa-mir-548c
Mature ID hsa-miR-548c-5p
Reads 
                       hsa-miR-548c-5p                     hsa-miR-548c-3p                          Count     RPM (mean number of reads per million)
........................AAAAGUAAUUGCGGUUUUUG.....................................................  4         0.176
........................AAAAGUAAUUGCGGUUUUU......................................................  2         0.177
CAUUGGCAUCUAUUAGGUUGGUGCAAAAGUAAUUGCGGUUUUUGCCAUUACUUUCAGUAGCAAAAAUCUCAAUUACUUUUGCACCAACUUAAUACUU
..........(((((((((((((((((((((((((.(((((((((...(((.....)))))))))))).)))))))))))))))))))))))))... (-46.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 5embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 6melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000105 28 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 14melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 4melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 4melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 11melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 2melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000158 1squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000173 4 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000184 1squamous cell GEO : GSM532920 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).