Deep sequencing reads for mature sequence MIMAT0004798

Stem-loop ID hsa-mir-548b
Mature ID hsa-miR-548b-5p
Reads 
                       hsa-miR-548b-5p                     hsa-miR-548b-3p                          Count     RPM (mean number of reads per million)
........................AAAAGUAAUUGUGGUUUUGGCC...................................................  1         3.22
............................................................CAAGAACCUCAGUUGCUUUUGU...............  7         1.17
CAGACUAUAUAUUUAGGUUGGCGCAAAAGUAAUUGUGGUUUUGGCCUUUAUUUUCAAUGGCAAGAACCUCAGUUGCUUUUGUGCCAACCUAAUACUU
............(((((((((((((((((((((((.((((((.(((............))).)))))).)))))))))))))))))))))))..... (-48.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 5embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 7embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000107 10melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 4melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 3melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 2melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 6melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 2melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 4melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000160 6squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000164 6squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 2 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000174 5squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000175 1 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000178 1squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000180 2squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 1 GEO : GSM337571 antibody: anti-Ago2 11A9
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).