Deep sequencing reads for mature sequence MIMAT0004688

Stem-loop ID hsa-mir-374a
Mature ID hsa-miR-374a-3p
Reads
          hsa-miR-374a-5p               hsa-miR-374a-3p                    Count     RPM (mean number of reads per million)
...........UUAUAAUACAACCUGAUAAGUG.......................................  968       29.1
...........UUAUAAUACAACCUGAUAAGU........................................  270       11
...........UUAUAAUACAACCUGAUAAGUGU......................................  26        0.601
...........UUAUAAUACAACCUGAUAAG.........................................  21        0.49
...........UUAUAAUACAACCUGAUA...........................................  1         17.4
...........UUAUAAUACAACCUGAUAA..........................................  1         55.2
............UAUAAUACAACCUGAUAAGUG.......................................  2         0.0421
............UAUAAUACAACCUGAUAAGU........................................  2         0.0421
.............AUAAUACAACCUGAUAAGUG.......................................  2         0.0305
........................................ACUUAUCAGAUUGUAUUGUAA...........  4         0.157
........................................ACUUAUCAGAUUGUAUUGUAAU..........  2         0.0526
.........................................CUUAUCAGAUUGUAUUGUAAUU.........  1145      24.1
.........................................CUUAUCAGAUUGUAUUGUAAU..........  141       3.29
.........................................CUUAUCAGAUUGUAUUGUAA...........  23        0.547
.........................................CUUAUCAGAUUGUAUUGUA............  2         0.0787
.........................................CUUAUCAGAUUGUAUUGU.............  1         2.3
..........................................UUAUCAGAUUGUAUUGUAAUU.........  5         0.109
..........................................UUAUCAGAUUGUAUUGUAAU..........  2         0.0423
...........................................UAUCAGAUUGUAUUGUAAUU.........  3         0.0458
UACAUCGGCCAUUAUAAUACAACCUGAUAAGUGUUAUAGCACUUAUCAGAUUGUAUUGUAAUUGUCUGUGUA
(((((.(((.((((((((((((.(((((((((((....))))))))))).)))))))))))).))).))))) (-35.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 9embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 4embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 173melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 105melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 160 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 61melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 232melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 468melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 198melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 305melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 264melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 353melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 216melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 254melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 9 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000136 1squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000147 35 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000149 1 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000157 19 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 136 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000163 1 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000165 197 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000169 3 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000170 1adenosquamous cell GEO : GSM532906 [ Witten D et al.]
ER0000000171 115 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000175 6 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000181 90 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 1whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000187 1 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000193 2 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 1squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 3 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 20 GEO : GSM337571 antibody: anti-Ago2 11A9
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3