Deep sequencing reads for mature sequence MIMAT0004615

Stem-loop ID

hsa-mir-195

Mature ID

hsa-miR-195-3p

Reads

             hsa-miR-195-5p                        hsa-miR-195-3p                        Count     RPM (mean number of reads per million)
..............UAGCAGCACAGAAAUAUUGGCA...................................................  182       3.76
..............UAGCAGCACAGAAAUAUUGGC....................................................  43        79.5
..............UAGCAGCACAGAAAUAUUGG.....................................................  10        26.7
..............UAGCAGCACAGAAAUAUU.......................................................  3         61.5
..............UAGCAGCACAGAAAUAUUG......................................................  1         1.99
..............UAGCAGCACAGAAAUAU........................................................  1         17.9
....................................................CCAAUAUUGGCUGUGCUGCUCC.............  3         0.45
....................................................CCAAUAUUGGCUGUGCUGCUCCA............  3         0.45
AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAUAUUGGCUGUGCUGCUCCAGGCAGGGUGGUG
.(((.(((((.((..((((((((((.((((((((((..............))))))))))..))))))))))..)).))))).))). (-46.44)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	10	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000103	42	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	10	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	110		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	22	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	16	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	37	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	95	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	7	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	30	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	7	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	20	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	27	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000135	46		GEO : GSM532871	normal cervix	[ Witten D et al.]
ER0000000136	1	squamous cell	GEO : GSM532872		[ Witten D et al.]
ER0000000141	9		GEO : GSM532877	normal cervix	[ Witten D et al.]
ER0000000142	2	squamous cell	GEO : GSM532878		[ Witten D et al.]
ER0000000147	285		GEO : GSM532883	normal cervix	[ Witten D et al.]
ER0000000148	5	squamous cell	GEO : GSM532884		[ Witten D et al.]
ER0000000157	177		GEO : GSM532893	normal cervix	[ Witten D et al.]
ER0000000161	251		GEO : GSM532897	normal cervix	[ Witten D et al.]
ER0000000165	276		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000169	60		GEO : GSM532905	normal cervix	[ Witten D et al.]
ER0000000171	224		GEO : GSM532907	normal cervix	[ Witten D et al.]
ER0000000175	10		GEO : GSM532911	normal cervix	[ Witten D et al.]
ER0000000176	5	adenosquamous cell	GEO : GSM532912		[ Witten D et al.]
ER0000000181	88		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000182	2	squamous cell	GEO : GSM532918		[ Witten D et al.]
ER0000000183	1	whole body	GEO : GSM532919	normal cervix	[ Witten D et al.]
ER0000000193	2		GEO : GSM532929	normal cervix	[ Witten D et al.]
ER0000000194	1	squamous cell	GEO : GSM532930		[ Witten D et al.]
ER0000000262	13		GEO : GSM337570	antibody: anti-Ago1 4B8
ER0000000263	16		GEO : GSM337571	antibody: anti-Ago2 11A9
ER0000000264	39		GEO : GSM368181	tissue: undifferentiated NPC	[ Zhu JY et al.]
ER0000000266	2		GEO : GSM368183	tissue: undifferentiated NPC	[ Zhu JY et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).