Deep sequencing reads for mature sequence MIMAT0004586

Stem-loop ID hsa-mir-15b
Mature ID hsa-miR-15b-3p
Reads 
                   hsa-miR-15b-5p                        hsa-miR-15b-3p                              Count     RPM (mean number of reads per million)
.UGAGGCCUUAAAGUACUG...............................................................................  3         0.0499
..................GUAGCAGCACAUCAUGGUUUACA.........................................................  1         0.159
...................UAGCAGCACAUCAUGGUUUACA.........................................................  8553      421
...................UAGCAGCACAUCAUGGUUUAC..........................................................  2343      1.71e+03
...................UAGCAGCACAUCAUGGUUUA...........................................................  1156      42.7
...................UAGCAGCACAUCAUGGUUU............................................................  585       968
...................UAGCAGCACAUCAUGGUU.............................................................  70        64
...................UAGCAGCACAUCAUGGUUUACAU........................................................  44        13.4
...................UAGCAGCACAUCAUGGU..............................................................  11        0.297
...................UAGCAGCACAUCAUGGUUUACAUGC......................................................  2         0.0485
...................UAGCAGCACAUCAUGGUUUACAUG.......................................................  2         0.0485
....................AGCAGCACAUCAUGGUUUACA.........................................................  12        0.78
....................AGCAGCACAUCAUGGUUUAC..........................................................  7         0.529
.....................GCAGCACAUCAUGGUUUACA.........................................................  3         0.314
......................CAGCACAUCAUGGUUUACA.........................................................  1         0.159
.........................................................CGAAUCAUUAUUUGCUGCUCUA...................  147       7.84
.........................................................CGAAUCAUUAUUUGCUGCUCU....................  122       5.15
.........................................................CGAAUCAUUAUUUGCUGCU......................  25        0.656
.........................................................CGAAUCAUUAUUUGCUGCUC.....................  25        3.02
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU
.((((.(((((((...(((.(((((((.((.((((((..(((.((.......)))))..)))))).)).))))))).)))...)))))))...)))). (-32.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 1519embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 586embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 571melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 60melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 442 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 235melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 595melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 2058melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 625melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 1037melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2769melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 1005melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 461melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 1058melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000136 8squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000142 11squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000148 2squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000158 1squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000159 2 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000162 3squamous cell GEO : GSM532898 [ Witten D et al.]
ER0000000172 2squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000176 28adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000182 3squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000184 8squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000193 1 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 6squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 745 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 323 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 520 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 28 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 42 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 20 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).