Deep sequencing reads for mature sequence MIMAT0004561

Stem-loop ID hsa-mir-187
Mature ID hsa-miR-187-5p
Reads 
                                  hsa-miR-187-5p                      hsa-miR-187-3p                            Count     RPM (mean number of reads per million)
.................................GGGCUACAACACAGGACCCGGG......................................................  2         0.584
..................................GGCUACAACACAGGACCCGGG......................................................  5         1.46
..................................GGCUACAACACAGGACCCGGGC.....................................................  3         0.876
..................................GGCUACAACACAGGACCCGGGCG....................................................  2         0.584
...................................GCUACAACACAGGACCCGGGCG....................................................  10        0.412
...................................................................CCCUCGUGUCUUGUGUUGCA......................  1         5.78
.....................................................................CUCGUGUCUUGUGUUGCAGCCGG.................  2         0.0842
.....................................................................CUCGUGUCUUGUGUUGCAGCCG..................  1         0.292
......................................................................UCGUGUCUUGUGUUGCAGCCGG.................  79        145
......................................................................UCGUGUCUUGUGUUGCAGCCGGA................  11        1.49
......................................................................UCGUGUCUUGUGUUGCAGCCG..................  9         1.38
......................................................................UCGUGUCUUGUGUUGCAG.....................  3         63.5
GGUCGGGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUGCUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA
.(.((((((.............((((...((((.((((.(((((((((((.((((.((......).).)).)).))))))))))).)))).))))..))))))))))). (-47.91)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 44embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 3embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000110 3melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 15melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 102melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000147 1 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000160 2squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000161 3 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000164 1squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 1 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 1 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 2 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 6 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).