Deep sequencing reads for mature sequence MIMAT0004497

Stem-loop ID hsa-mir-24-2
Mature ID hsa-miR-24-2-5p
Reads 
           hsa-miR-24-2-5p                        hsa-miR-24-3p             Count     RPM (mean number of reads per million)
........CCCGUGCCUACUGAGCUGAAACACAGU......................................  1         20.8
........CCCGUGCCUACUGAGCUGAAACA..........................................  1         20.8
........CCCGUGCCUACUGAGCUGAAACACA........................................  1         20.8
........CCCGUGCCUACUGAGCUGAAACACAG.......................................  1         20.8
...........GUGCCUACUGAGCUGAAACACAGU......................................  147       6.11
...........GUGCCUACUGAGCUGAAACACAG.......................................  89        1.05
...........GUGCCUACUGAGCUGAAACACA........................................  51        0.721
...........GUGCCUACUGAGCUGAAACAC.........................................  7         0.109
...........GUGCCUACUGAGCUGAAACACAGUU.....................................  4         0.0423
...........GUGCCUACUGAGCUGAAACA..........................................  2         0.0545
............UGCCUACUGAGCUGAAACACAGU......................................  7         0.0905
...............CUACUGAGCUGAAACAC.........................................  1         12
................UACUGAGCUGAAACACA........................................  1         12
...............................................ACUGGCUCAGUUCAGCAGGAACA...  7         0.0871
...............................................ACUGGCUCAGUUCAGCAGGAACAG..  3         0.0317
...............................................ACUGGCUCAGUUCAGCAGGA......  2         0.0211
...............................................ACUGGCUCAGUUCAGCAGGAAC....  1         0.17
................................................CUGGCUCAGUUCAGCAGGAACAG..  64        0.85
................................................CUGGCUCAGUUCAGCAGGAACA...  43        0.631
................................................CUGGCUCAGUUCAGCAGGAAC....  2         0.0211
.................................................UGGCUCAGUUCAGCAGGAACAG..  27857     569
.................................................UGGCUCAGUUCAGCAGGAACA...  4009      101
.................................................UGGCUCAGUUCAGCAGGAAC....  1837      234
.................................................UGGCUCAGUUCAGCAGGAA.....  304       17.6
.................................................UGGCUCAGUUCAGCAGGA......  81        13.5
.................................................UGGCUCAGUUCAGCAGG.......  59        300
.................................................UGGCUCAGUUCAGCAGGAACAGG.  48        1.35
..................................................GGCUCAGUUCAGCAGGAACAG..  64        1.14
..................................................GGCUCAGUUCAGCAGGAACA...  7         0.401
...................................................GCUCAGUUCAGCAGGAACAG..  3         1.36
...................................................GCUCAGUUCAGCAGGAACAGG.  2         0.0139
......................................................CAGUUCAGCAGGAACAG..  1         12
CUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGGUUUGUGUACACUGGCUCAGUUCAGCAGGAACAGGG
(((((..(((..(((..(((((((((..((((((.....))))))....)))))))))...)))))).))))) (-27.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 83embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 2918embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 8155melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 2299melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 9267 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 778melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 2346melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 13065melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 1730melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 7556melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 5581melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 5300melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 3865melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 4659melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 40 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000138 2squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000140 4squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000141 77 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000147 136 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000150 6squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000151 23 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000156 4squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 284 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000159 7 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000161 574 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000163 4 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000164 2squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 324 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 3 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000169 168 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 192 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 6 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 23squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000175 21 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000177 15 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 2 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000180 2squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000181 189 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 5whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000185 6 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 1 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000188 2squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000193 11 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 1squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 8 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 23 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 38 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 4 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 68 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 18 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).