Deep sequencing reads for mature sequence MIMAT0004494

Stem-loop ID hsa-mir-21
Mature ID hsa-miR-21-3p
Reads 
        hsa-miR-21-5p                        hsa-miR-21-3p                Count     RPM (mean number of reads per million)
....GGGUAGCUUAUCAGACUGAUGUUGA...........................................  1225      4.01e+03
....GGGUAGCUUAUCAGACUGAUGU..............................................  205       305
....GGGUAGCUUAUCAGACUGAUGUU.............................................  135       144
....GGGUAGCUUAUCAGACUGAUG...............................................  77        142
....GGGUAGCUUAUCAGACUGAUGUUGACU.........................................  75        127
....GGGUAGCUUAUCAGACUGAUGUUGAC..........................................  55        140
....GGGUAGCUUAUCAGACUGAUGUUG............................................  36        103
....GGGUAGCUUAUCAGACUGAU................................................  31        83.6
....GGGUAGCUUAUCAGACUGA.................................................  18        41.8
....GGGUAGCUUAUCAGACUG..................................................  15        132
....GGGUAGCUUAUCAGACU...................................................  7         39.2
......GUAGCUUAUCAGACUGAUGUUGA...........................................  884       20.7
......GUAGCUUAUCAGACUGAUGUUGAC..........................................  310       7.8
......GUAGCUUAUCAGACUGAUGUUG............................................  123       4.19
......GUAGCUUAUCAGACUGAUGUUGACU.........................................  53        0.764
......GUAGCUUAUCAGACUGAUGUU.............................................  11        0.168
......GUAGCUUAUCAGACUGAUGU..............................................  2         0.0207
.......UAGCUUAUCAGACUGAUGUUGAC..........................................  301690    1.24e+04
.......UAGCUUAUCAGACUGAUGUUGA...........................................  184371    4.43e+03
.......UAGCUUAUCAGACUGAUGUUG............................................  19478     524
.......UAGCUUAUCAGACUGAUGUUGACU.........................................  12168     197
.......UAGCUUAUCAGACUGAUGUU.............................................  3216      67.1
.......UAGCUUAUCAGACUGAUGU..............................................  819       23.6
.......UAGCUUAUCAGACUGAUG...............................................  680       46.5
.......UAGCUUAUCAGACUGAU................................................  128       59.4
.......UAGCUUAUCAGACUGAUGUUGACUGU.......................................  81        0.981
.......UAGCUUAUCAGACUGAUGUUGACUG........................................  38        0.439
.......UAGCUUAUCAGACUGAUGUUGACUGUU......................................  5         0.0518
........AGCUUAUCAGACUGAUGUUGAC..........................................  1230      28
........AGCUUAUCAGACUGAUGUUGACU.........................................  682       9.21
........AGCUUAUCAGACUGAUGUUGA...........................................  353       7.85
........AGCUUAUCAGACUGAUGUUG............................................  52        1.23
........AGCUUAUCAGACUGAUGUU.............................................  3         0.0484
........AGCUUAUCAGACUGAUG...............................................  2         0.0287
.........GCUUAUCAGACUGAUGUUGAC..........................................  68        1.06
.........GCUUAUCAGACUGAUGUUGA...........................................  66        1.06
.........GCUUAUCAGACUGAUGUUG............................................  5         0.077
.........GCUUAUCAGACUGAUGUUGACU.........................................  2         0.0287
..........CUUAUCAGACUGAUGUUGAC..........................................  3         0.297
..........CUUAUCAGACUGAUGUUG............................................  2         23.6
..........CUUAUCAGACUGAUGUUGA...........................................  1         11.8
...........UUAUCAGACUGAUGUUGAC..........................................  70        42
...........UUAUCAGACUGAUGUUGA...........................................  26        50.1
...........UUAUCAGACUGAUGUUG............................................  4         49.3
...........UUAUCAGACUGAUGUUGACU.........................................  2         0.0207
............UAUCAGACUGAUGUUGAC..........................................  47        52.6
............UAUCAGACUGAUGUUGA...........................................  16        12.3
............UAUCAGACUGAUGUUGACU.........................................  1         0.0992
.............AUCAGACUGAUGUUGAC..........................................  9         37.9
.............................................CAACACCAGUCGAUGGGCUGUC.....  2924      116
.............................................CAACACCAGUCGAUGGGCUGU......  2064      47.2
.............................................CAACACCAGUCGAUGGGCUG.......  157       4.1
.............................................CAACACCAGUCGAUGGGCUGUCU....  113       3.22
.............................................CAACACCAGUCGAUGGGCU........  68        4.11
.............................................CAACACCAGUCGAUGGGC.........  18        0.18
.............................................CAACACCAGUCGAUGGG..........  10        0.104
..............................................AACACCAGUCGAUGGGCUGUCU....  47        0.759
..............................................AACACCAGUCGAUGGGCUGUC.....  18        0.268
..............................................AACACCAGUCGAUGGGCUGU......  13        0.159
...............................................ACACCAGUCGAUGGGCUGUC.....  7         0.0746
...............................................ACACCAGUCGAUGGGCUGUCU....  1         0.0992
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA
.(((((..((((((((.(((((.(((((.((((.(.....)))))))))).)))))))))))))..))))). (-35.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 65494embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 36583embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 47289melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 9635melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 81083 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 9852melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 10258melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 70374melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 9018melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 84576melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 71624melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 31235melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 55245melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 25358melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000136 5squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000138 519squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000140 558squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000141 2 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000142 1squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000146 14squamous cell GEO : GSM532882 [ Witten D et al.]
ER0000000148 1squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000150 1569squamous cell GEO : GSM532886 [ Witten D et al.]
ER0000000152 1squamous cell GEO : GSM532888 [ Witten D et al.]
ER0000000154 8squamous cell GEO : GSM532890 [ Witten D et al.]
ER0000000156 2202squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000158 1squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000160 1135squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000162 2squamous cell GEO : GSM532898 [ Witten D et al.]
ER0000000164 3302squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000168 546adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000170 5adenosquamous cell GEO : GSM532906 [ Witten D et al.]
ER0000000172 10squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 1249squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000176 17adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000178 270squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000180 863squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000182 3squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000184 1squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000186 1930squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000188 3413squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000189 2whole body GEO : GSM532925 normal cervix [ Witten D et al.]
ER0000000190 2squamous cell GEO : GSM532926 [ Witten D et al.]
ER0000000193 18 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 16squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 3 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 48 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 99 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 2 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 16 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).