Deep sequencing reads for mature sequence MIMAT0004489

Stem-loop ID hsa-mir-16-1
Mature ID hsa-miR-16-1-3p
Reads 
              hsa-miR-16-5p                           hsa-miR-16-1-3p                       Count     RPM (mean number of reads per million)
.............UAGCAGCACGUAAAUAUUGGCG......................................................  17990     1.28e+03
.............UAGCAGCACGUAAAUAUUGGCGU.....................................................  4593      164
.............UAGCAGCACGUAAAUAUUGG........................................................  410       327
.............UAGCAGCACGUAAAUAUUGGC.......................................................  310       184
.............UAGCAGCACGUAAAUAUU..........................................................  108       183
.............UAGCAGCACGUAAAUAUUG.........................................................  65        26.2
.............UAGCAGCACGUAAAUAUUGGCGUU....................................................  62        2.75
.............UAGCAGCACGUAAAUAU...........................................................  10        3.99
.............UAGCAGCACGUAAAUAUUGGCGUUA...................................................  2         0.0398
..............AGCAGCACGUAAAUAUUGGCG......................................................  23        0.388
..............AGCAGCACGUAAAUAUUGGCGU.....................................................  16        0.255
................CAGCACGUAAAUAUUGGCG......................................................  2         0.044
..................GCACGUAAAUAUUGGCG......................................................  2         46.4
.......................................................CCAGUAUUAACUGUGCUGCUGA............  6         0.477
.......................................................CCAGUAUUAACUGUGCUGCUG.............  4         0.824
.......................................................CCAGUAUUAACUGUGCUGCUGAA...........  4         0.0539
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC
((((((..(((.((((((((((((.((((((((.(.(((..........))).).)))))))).)).)))))))))).)))..)))))) (-37.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 299embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 234embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 3434melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 329melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 1278 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 480melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 898melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 4034melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 912melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 2826melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 4968melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 2416melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 896melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 1643melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 32 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000136 4squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000141 12 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000142 4squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000147 103 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000148 2squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000151 4 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000157 79 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000158 1squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000161 260 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 148 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 23 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 132 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000172 1squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000175 65 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000176 11adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000181 129 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000182 1squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000183 2whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000184 3squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000189 1whole body GEO : GSM532925 normal cervix [ Witten D et al.]
ER0000000190 1squamous cell GEO : GSM532926 [ Witten D et al.]
ER0000000194 1squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 338 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 233 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 299 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 12 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 25 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 3 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).