Deep sequencing reads for mature sequence MIMAT0004295

Stem-loop ID cbr-mir-235a
Mature ID cbr-miR-235a
Reads 
                                                         cbr-miR-235a               Count     RPM (mean number of reads per million)
.......................................................UAUUGCACUUUCCCUGGCC........  6         440
UCCGAUCCGGCCAUGGCCAAUUGCAUAUAUUGCUUUUACUUUUUCAAAAUGCGAAUAUUGCACUUUCCCUGGCCAGAUCUGA
...((((.(((((.((..((.((((.(((((((((((........)))).)).))))))))).))..))))))).))))... (-24.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000025 71whole body GEO : GSM378785 [ de Wit E et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).