Deep sequencing reads for mature sequence MIMAT0003935

Stem-loop ID ath-MIR776
Mature ID ath-miR776
Reads 
                                                                                    ath-miR776                         Count     RPM (mean number of reads per million)
..................ACUCAAUAGAAUUCUUAAGAU...............................................................................  4         126
.................................................................................UCUAAGUCUUCUAUUGAUGUUC...............  11        270
...................................................................................UAAGUCUUCUAUUGAUGUUC...............  1         31.4
UUGGGAUUAUAGCCACGAACUCAAUAGAAUUCUUAAGAUCAUGUGAAAACGUUGACAAGAUCGUCUACGAUUUUCCAAGAUUCUAAGUCUUCUAUUGAUGUUCAUGGCUUUAACCUGA
(..((.(((.(((((.(((((((((((((..((((..(((.((.((((((((.(((......))).))).))))))).)))..))))..))))))))).)))).))))).)))))..) (-47.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000005 1whole body GEO : GSM253624 [ Mi S et al.]
ER0000000006 11whole body GEO : GSM253625 [ Mi S et al.]
ER0000000208 4flower GEO : GSM118372 [ Rajagopalan R et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
2
PMID:18342361 "Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5' terminal nucleotide" Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H, Long C, Chen S, Hannon GJ, Qi Y. Cell. 133:116-127(2008).