Deep sequencing reads for mature sequence MIMAT0003879

Stem-loop ID hsa-mir-758
Mature ID hsa-miR-758-3p
Reads
              hsa-miR-758-5p                       hsa-miR-758-3p                          Count     RPM (mean number of reads per million)
...............AUGGUUGACCAGAGAGCACACG...................................................  3         0.0982
................UGGUUGACCAGAGAGCACACG...................................................  9         0.295
...................................................UUUGUGACCUGGUCCACUAAC................  2         152
...................................................UUUGUGACCUGGUCCACU...................  1         20.6
GCCUGGAUACAUGAGAUGGUUGACCAGAGAGCACACGCUUUAUUUGUGCCGUUUGUGACCUGGUCCACUAACCCUCAGUAUCUAAUGC
...(((((((.((((.((((.((((((...(((.((((.........).))).)))...)))))).))))...))))))))))).... (-29.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 12 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000147 2 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000161 3 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 4 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 5 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 2 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000181 3 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000266 1 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 2 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3