Deep sequencing reads for mature sequence MIMAT0003492

Stem-loop ID mmu-mir-702
Mature ID mmu-miR-702-3p
Reads 
        mmu-miR-702-5p                                                                mmu-miR-702-3p           Count     RPM (mean number of reads per million)
.........GUGAGUGGGGUGGUUGGCAUG...............................................................................  237       1.41
.........GUGAGUGGGGUGGUUGGCAU................................................................................  26        0.158
.........GUGAGUGGGGUGGUUGGCA.................................................................................  10        0.0607
.........GUGAGUGGGGUGGUUGGCAUGG..............................................................................  7         0.212
.........GUGAGUGGGGUGGUUGGCAUGGGUUGC.........................................................................  1         0.00628
..........UGAGUGGGGUGGUUGGCAUG...............................................................................  5         0.0393
..........UGAGUGGGGUGGUUGGCAUGGG.............................................................................  5         0.0244
..........UGAGUGGGGUGGUUGGCAUGGGUU...........................................................................  1         0.015
..........UGAGUGGGGUGGUUGGCAUGG..............................................................................  1         0.00822
.....................................................................................CAUGCCCACCCUUUACCCCGCUCC  1         0.00172
......................................................................................AUGCCCACCCUUUACCCCGCUC.  1         0.00436
......................................................................................AUGCCCACCCUUUACCCCGCU..  1         0.00629
.......................................................................................UGCCCACCCUUUACCCCGCUCC  13        0.149
.......................................................................................UGCCCACCCUUUACCCCGCUC.  5         0.0974
.......................................................................................UGCCCACCCUUUACCCCGCU..  4         0.0383
.......................................................................................UGCCCACCCUUUACCCCGC...  2         0.0197
..........................................................................................CCACCCUUUACCCCGCUCC  1         0.00559
CGGGACAAGGUGAGUGGGGUGGUUGGCAUGGGUUGCCCAUGGGGACUCGACGCUGUGCCCACAGCCUCCUGAUGUCCUCCUCACGCAUGCCCACCCUUUACCCCGCUCC
...........(((((((((((..((..((((((((....((((((((((.(((((....))))).))..)).)))).))....))).)))))))..))))))))))). (-49.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000034 1testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000036 1brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 2brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 1brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000040 4brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000044 1whole body GEO : GSM510448 Newborn. [ Chiang HR et al.]
ER0000000047 3whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 1whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 3whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 2whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 3whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 8whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 1embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000055 1embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000216 9bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 1bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 7spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 3spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 6spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 16spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 12spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 9spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 8spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 1peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 1spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 11lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 9bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000230 3bone marrow GEO : GSM539849 strain: C57BL/6J, gender: male
ER0000000231 37bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 3peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000234 8bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 2bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 10spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 1thymus GEO : GSM539856
ER0000000239 1spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 12spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 6lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 15lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 15lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 38spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 1lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 3lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 6 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 27 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000250 5brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 1lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 2kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000258 1testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000260 8spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 3lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).