Deep sequencing reads for mature sequence MIMAT0003336

Stem-loop ID hsa-mir-658
Mature ID hsa-miR-658
Reads 
                                                                hsa-miR-658                          Count     RPM (mean number of reads per million)
GCUCGGUUGCCGUGGUUGCGGGCCCUGCCCGCCCGCCAGCUCGCUGACAGCACGACUCAGGGCGGAGGGAAGUAGGUCCGUUGGUCGGUCGGGAACGAGG
.((((.((.((((.(..(((((((((.(((..(((((...(((.((....))))).....))))).))).))..)))))))....).).))).)))))). (-42.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000151 1 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000157 2 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000165 2 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 3 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000181 3 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).