Deep sequencing reads for mature sequence MIMAT0003260

Stem-loop ID hsa-mir-592
Mature ID hsa-miR-592
Reads 
                  hsa-miR-592                                                                      Count     RPM (mean number of reads per million)
...............UUGUGUCAAUAUGCGAUGAUGU............................................................  4         7.08
UAUUAUGCCAUGACAUUGUGUCAAUAUGCGAUGAUGUGUUGUGAUGGCACAGCGUCAUCACGUGGUGACGCAACAUCAUGACGUAAGACGUCACAAC
..(((((.(((((..((((((((.((((.((((((((..((((....)))))))))))).)))).))))))))..))))).)))))........... (-38.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 5embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000159 5 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 11 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).