Deep sequencing reads for mature sequence MIMAT0003250

Stem-loop ID hsa-mir-585
Mature ID hsa-miR-585
Reads 
                                                             hsa-miR-585                       Count     RPM (mean number of reads per million)
........................CUAGCACACAGAUACGCCCAGA................................................  4         3.07
............................................................UGGGCGUAUCUGUAUGCUAGGG............  4         1.66
UGGGGUGUCUGUGCUAUGGCAGCCCUAGCACACAGAUACGCCCAGAGAAAGCCUGAACGUUGGGCGUAUCUGUAUGCUAGGGCUGCUGUAACAA
...........((.((((((((((((((((.((((((((((((((.(..........).)))))))))))))).)))))))))))))))).)). (-54.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 4embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000105 7 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000161 4 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000171 1 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000181 1 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000182 1squamous cell GEO : GSM532918 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).