Deep sequencing reads for mature sequence MIMAT0003233

Stem-loop ID

hsa-mir-551b

Mature ID

hsa-miR-551b-3p

Reads

                    hsa-miR-551b-5p                       hsa-miR-551b-3p                         Count     RPM (mean number of reads per million)
.....................GAAAUCAAGCGUGGGUGAGACCU....................................................  27        4.26
.....................GAAAUCAAGCGUGGGUGAGACC.....................................................  2         0.0523
............................................................GCGACCCAUACUUGGUUUCAG...............  16        0.89
............................................................GCGACCCAUACUUGGUUUCA................  11        0.375
AGAUGUGCUCUCCUGGCCCAUGAAAUCAAGCGUGGGUGAGACCUGGUGCAGAACGGGAAGGCGACCCAUACUUGGUUUCAGAGGCUGUGAGAAUAA
........((((.(((((..((((((((((..((((((...((((........))))....).)))))..))))))))))..))))).)))).... (-40.00)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	2	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000002	12	embryonic stem cell	GEO : GSM541797		[ Bar M et al.]
ER0000000105	2		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000108	90	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	6	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	2	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	31	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	12	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	14	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000149	1		GEO : GSM532885	normal cervix	[ Witten D et al.]
ER0000000159	7		GEO : GSM532895	normal cervix	[ Witten D et al.]
ER0000000167	2		GEO : GSM532903	normal cervix	[ Witten D et al.]
ER0000000169	1		GEO : GSM532905	normal cervix	[ Witten D et al.]
ER0000000173	2		GEO : GSM532909	normal cervix	[ Witten D et al.]
ER0000000174	1	squamous cell	GEO : GSM532910		[ Witten D et al.]
ER0000000177	4		GEO : GSM532913	normal cervix	[ Witten D et al.]
ER0000000178	2	squamous cell	GEO : GSM532914		[ Witten D et al.]
ER0000000185	16		GEO : GSM532921	normal cervix	[ Witten D et al.]
ER0000000187	4		GEO : GSM532923	normal cervix	[ Witten D et al.]
ER0000000188	1	squamous cell	GEO : GSM532924		[ Witten D et al.]
ER0000000264	6		GEO : GSM368181	tissue: undifferentiated NPC	[ Zhu JY et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).