Deep sequencing reads for mature sequence MIMAT0002890

Stem-loop ID hsa-mir-299
Mature ID hsa-miR-299-5p
Reads
      hsa-miR-299-5p                  hsa-miR-299-3p              Count     RPM (mean number of reads per million)
...AAAUGGUUUACCGUCCCACAUACA....................................  38        319
...AAAUGGUUUACCGUCCCACAUACAU...................................  29        396
...AAAUGGUUUACCGUCCCACAUAC.....................................  17        130
...AAAUGGUUUACCGUCCCACAUA......................................  1         8.01
...AAAUGGUUUACCGUCCCA..........................................  1         7.84
...AAAUGGUUUACCGUCCCACAU.......................................  1         8.01
.....AUGGUUUACCGUCCCACAUACA....................................  16        0.443
.....AUGGUUUACCGUCCCACAUAC.....................................  4         0.111
......UGGUUUACCGUCCCACAUACAU...................................  47        1.3
......UGGUUUACCGUCCCACAUACA....................................  10        0.277
......UGGUUUACCGUCCCACAUAC.....................................  3         0.0831
.....................................GUAUGUGGGAUGGUAAACCGCU....  6         0.166
.....................................GUAUGUGGGAUGGUAAACCGC.....  4         0.204
......................................UAUGUGGGAUGGUAAACCGCUU...  28        0.869
......................................UAUGUGGGAUGGUAAACCGCU....  3         0.0831
......................................UAUGUGGGAUGGUAAACC.......  2         0.0554
AAGAAAUGGUUUACCGUCCCACAUACAUUUUGAAUAUGUAUGUGGGAUGGUAAACCGCUUCUU
(((((.((((((((((((((((((((((.......)))))))))))))))))))))).))))) (-40.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000104 4melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 134 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000139 1 GEO : GSM532875 normal cervix [ Witten D et al.]
ER0000000155 4 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 24 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 15 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 35 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 55 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 14 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 11 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000180 1squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000185 28 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 13 GEO : GSM532923 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2