Deep sequencing reads for mature sequence MIMAT0002874

Stem-loop ID hsa-mir-503
Mature ID hsa-miR-503-5p
Reads
     hsa-miR-503-5p                          hsa-miR-503-3p              Count     RPM (mean number of reads per million)
..CCCUAGCAGCGGGAACAGUUCUGCA............................................  42        407
..CCCUAGCAGCGGGAACAGUUCU...............................................  20        190
..CCCUAGCAGCGGGAACAGUUCUGC.............................................  13        138
..CCCUAGCAGCGGGAACAGU..................................................  5         30.3
..CCCUAGCAGCGGGAACA....................................................  5         59.7
..CCCUAGCAGCGGGAACAGUUCUGCAG...........................................  2         40.5
..CCCUAGCAGCGGGAACAGUUCUG..............................................  2         14.3
..CCCUAGCAGCGGGAACAGUUC................................................  2         9.7
..CCCUAGCAGCGGGAACAGUU.................................................  2         9.33
.....UAGCAGCGGGAACAGUUCUGCAG...........................................  1746      41.5
.....UAGCAGCGGGAACAGUUCUG..............................................  582       15.9
.....UAGCAGCGGGAACAGUUCUGCA............................................  525       23.1
.....UAGCAGCGGGAACAGUUCU...............................................  404       23
.....UAGCAGCGGGAACAGUUC................................................  68        1.09
.....UAGCAGCGGGAACAGUUCUGCAGU..........................................  65        2.01
.....UAGCAGCGGGAACAGUUCUGC.............................................  47        13.1
.....UAGCAGCGGGAACAGUU.................................................  23        2.79
......AGCAGCGGGAACAGUUCUGCAG...........................................  13        0.192
..........................AGUGAGCGAUCGGUGCUCU..........................  1         20.8
............................................UGGGGUAUUGUUUCCGCUGCCA.....  1         0.295
.............................................GGGGUAUUGUUUCCGCUGCCAGG...  14        2.49
.............................................GGGGUAUUGUUUCCGCUGCCA.....  2         0.59
.............................................GGGGUAUUGUUUCCGCUGCCAG....  1         0.295
..............................................GGGUAUUGUUUCCGCUGCCAGG...  2         0.59
..............................................GGGUAUUGUUUCCGCUGCCA.....  1         0.295
UGCCCUAGCAGCGGGAACAGUUCUGCAGUGAGCGAUCGGUGCUCUGGGGUAUUGUUUCCGCUGCCAGGGUA
((((((.((((((((((((((.((.((..(((((.....))))))).)).)))))))))))))).)))))) (-42.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 33embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 113embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 1002melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 70melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 2708 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 86melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 37melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 2612melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 155melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 233melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 181melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 264melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 979melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 246melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 1 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000141 5 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000147 67 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000151 2 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000157 26 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000161 44 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 27 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 22 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 119 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000175 1 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000181 51 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 8whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000193 1 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000262 6 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 15 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 4 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4