Deep sequencing reads for mature sequence MIMAT0002852

Stem-loop ID hsa-mir-517a
Mature ID hsa-miR-517a-3p
Reads 
              hsa-miR-517-5p                        hsa-miR-517a-3p                       Count     RPM (mean number of reads per million)
.....................................................AUCGUGCAUCCCUUUAGAGUGU............  18        67.1
......................................................UCGUGCAUCCCUUUAGAGUGU............  3         0.967
UCUCAGGCAGUGACCCUCUAGAUGGAAGCACUGUCUGUUGUAUAAAAGAAAAGAUCGUGCAUCCCUUUAGAGUGUUACUGUUUGAGA
((((((((((((((.(((((((.(((.((((.((((.((.(.....).)).)))).)))).))).))))))).)))))))))))))) (-42.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 3embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000114 19melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000177 4 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000266 2 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).