Deep sequencing reads for mature sequence MIMAT0002848

Stem-loop ID hsa-mir-518c
Mature ID hsa-miR-518c-3p
Reads
                      hsa-miR-518c-5p                       hsa-miR-518c-3p                            Count     RPM (mean number of reads per million)
........................CUCUGGAGGGAAGCACUUUCUGUU.....................................................  2         0.379
..........................................................AAACAAAGCGCUUCUCUUUAGAGU...................  2         43.2
.............................................................CAAAGCGCUUCUCUUUAGAGU...................  1         1.31
.............................................................CAAAGCGCUUCUCUUUAGAGUG..................  1         1.31
.............................................................CAAAGCGCUUCUCUUUAGAGUGU.................  1         1.31
GCGAGAAGAUCUCAUGCUGUGACUCUCUGGAGGGAAGCACUUUCUGUUGUCUGAAAGAAAACAAAGCGCUUCUCUUUAGAGUGUUACGGUUUGAGAAAAGC
.........(((((.((((((((.((((((((((((((.(((..((((.((.....)).))))))).)))))))))))))).)))))))).)))))..... (-46.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 3embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000114 10melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3