Deep sequencing reads for mature sequence MIMAT0002840

Stem-loop ID hsa-mir-523
Mature ID hsa-miR-523-3p
Reads 
               hsa-miR-523-5p                       hsa-miR-523-3p                       Count     RPM (mean number of reads per million)
...............CUCUAGAGGGAAGCGCUUUCUG..................................................  2         0.505
.................................................AAAGAACGCGCUUCCCUAUAGAG...............  1         23.6
UCUCAUGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAACGCGCUUCCCUAUAGAGGGUUACCCUUUGAGA
(((((....(((((((((((.((((((((((.((((....((.....))..)))).)))))))))).)))))))))))....))))) (-49.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000114 6melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000177 1 GEO : GSM532913 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).