Deep sequencing reads for mature sequence MIMAT0002834

Stem-loop ID

hsa-mir-520a

Mature ID

hsa-miR-520a-3p

Reads

            hsa-miR-520a-5p                       hsa-miR-520a-3p                      Count     RPM (mean number of reads per million)
..............CUCCAGAGGGAAGUACUUUCU..................................................  3         0.568
....................................................AAAGUGCUUCCCUUUGGACUG............  8         1.47
....................................................AAAGUGCUUCCCUUUGGACUGU...........  2         0.379
CUCAGGCUGUGACCCUCCAGAGGGAAGUACUUUCUGUUGUCUGAGAGAAAAGAAAGUGCUUCCCUUUGGACUGUUUCGGUUUGAG
(((((((((.(((..((((((((((((((((((((.((.((...)).)).))))))))))))))))))))..))).))))))))) (-48.50)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	1	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000113	2	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	11	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000174	2	squamous cell	GEO : GSM532910		[ Witten D et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).