Deep sequencing reads for mature sequence MIMAT0001635

Stem-loop ID hsa-mir-452
Mature ID hsa-miR-452-5p
Reads 
             hsa-miR-452-5p                              hsa-miR-452-3p                 Count     RPM (mean number of reads per million)
.............AACUGUUUGCAGAGGAAACUGAG.................................................  341       9.1
.............AACUGUUUGCAGAGGAAACUGAGA................................................  197       6.46
.............AACUGUUUGCAGAGGAAACUGA..................................................  78        1.94
.............AACUGUUUGCAGAGGAAACUG...................................................  2         0.0424
..............ACUGUUUGCAGAGGAAACUGAG.................................................  2         0.0424
...............CUGUUUGCAGAGGAAACUGAGA................................................  5         0.106
................UGUUUGCAGAGGAAACUGAGAC...............................................  156       4.81
................UGUUUGCAGAGGAAACUGAGA................................................  21        0.705
................UGUUUGCAGAGGAAACUGAGACU..............................................  8         0.264
................UGUUUGCAGAGGAAACUGAG.................................................  5         13.4
GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUCAUCUGCAAAGAAGUAAGUGCUUUGC
((.((((((((((...(.((((((((.((.((((((((...........)))))))).)).)))))))).).)))))))))).)) (-40.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 1embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000104 8melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 698 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000110 256melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000114 7melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000155 3 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 82 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 23 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 34 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000172 1squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000173 29 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000176 3adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 139 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 8 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000185 2 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 1 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000266 1 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).